Display Settings:

Format

Send to:

Choose Destination
Pr012668019

STS probe REN89053 for opsin 1, long wave sensitive (OPN1LW) and 2 more genes

Synopsis

Field NameValues
NameREN89053
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesOPN1LW; OPN1MW2; OPN1LW
UniSTS IDUniSTS:413851

Sequences

>Probe|12668019|PRIMERF Forward PCR primer (outermost) (24b)
ACTTTTGGGTTGCTTCTACCATGT
>Probe|12668019|PRIMERR Reverse PCR primer (outermost) (24b)
AAGAATGGCTTTTAACATCTGTCG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmREN89053

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID413851
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center