Display Settings:

Format

Send to:

Choose Destination
Pr012667731

STS probe REN88794 for methyl-CpG binding protein 2 (MECP2) and 1 more gene

Synopsis

Field NameValues
NameREN88794
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMECP2; MECP2
UniSTS IDUniSTS:413592

Sequences

>Probe|12667731|PRIMERF Forward PCR primer (outermost) (26b)
TACCACCTGTTCCCCTAAAATCTATG
>Probe|12667731|PRIMERR Reverse PCR primer (outermost) (24b)
GATCTGTCAGCAAGTCCTGTTAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmREN88794

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID413592
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center