Display Settings:

Format

Send to:

Choose Destination
Pr012667532

STS probe REN88614 for methyl-CpG binding protein 2 (MECP2) and 3 more genes

Synopsis

Field NameValues
NameREN88614
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMECP2; MECP2; MECP2; MECP2
UniSTS IDUniSTS:413412

Sequences

>Probe|12667532|PRIMERF Forward PCR primer (outermost) (25b)
GAGATGTTCCAATCTAGTGACAAGG
>Probe|12667532|PRIMERR Reverse PCR primer (outermost) (23b)
AGCTCTGTGCTGGGACAGATTAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmREN88614

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID413412
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center