Display Settings:

Format

Send to:

Choose Destination
Pr012660921

STS probe D15S1249 for 3-hydroxyacyl-CoA dehydratase 3 (HACD3) and 2 more genes

Synopsis

Field NameValues
NameD15S1249
AliasesRH29777; SHGC-14524
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesHACD3; LOC652500; LOC732402
UniSTS IDUniSTS:40746

Sequences

>Probe|12660921|PRIMERF Forward PCR primer (outermost) (19b)
CTTTCAAAGCATTCTGCGC
>Probe|12660921|PRIMERR Reverse PCR primer (outermost) (25b)
ACTTTACATCTGACATCCTTTGTCC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3152242 cr10000SHGC-14524
Homo sapienslinkageRutgers Map15 cmD15S1249
Homo sapiensradiation hybridNCBI RH15413.1 crSHGC-14524

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID40746
Probe Cross-refcontext specific help for: Probe Cross-refGDB:736215
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center