Display Settings:

Format

Send to:

Choose Destination
Pr012660796

STS probe REN82549 for chromosome 21 open reading frame 62 (C21orf62) and 1 more gene

Synopsis

Field NameValues
NameREN82549
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesC21H21orf62; C21orf62
UniSTS IDUniSTS:407347

Sequences

>Probe|12660796|PRIMERF Forward PCR primer (outermost) (24b)
CACCCAGCCTGAATAGTTCTGTAG
>Probe|12660796|PRIMERR Reverse PCR primer (outermost) (24b)
CGCTGTGCTTGTTCTCTGTCTAGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map21 cmREN82549

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID407347
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center