Display Settings:

Format

Send to:

Choose Destination
Pr012660777

STS probe Cda16d10 for phospholipid transfer protein (PLTP) and 5 more genes

Synopsis

Field NameValues
NameCda16d10
AliasesD20F2201E; RH10228
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCTSA; PLTP; CTSA; PLTP; PLTP; CTSA
UniSTS IDUniSTS:40733

Sequences

>Probe|12660777|PRIMERF Forward PCR primer (outermost) (21b)
CTTTATTCCCGCAGCAGTTCC
>Probe|12660777|PRIMERR Reverse PCR primer (outermost) (18b)
TACAGTCCGTCCACCACC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB420257.44 cr3000Cda16d10
Homo sapienslinkageRutgers Map20 cmCda16d10
Homo sapiensradiation hybridNCBI RH20444.9 crCda16d10

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID40733
Probe Cross-refcontext specific help for: Probe Cross-refGDB:451794; GDB:452077
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center