Display Settings:

Format

Send to:

Choose Destination
Pr012660210

Homo sapiens STS probe D4S869

Synopsis

Field NameValues
NameD4S869
AliasesHUM4STS687; RH29009; RH72681; SHGC4-687
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:40682

Sequences

>Probe|12660210|PRIMERF Forward PCR primer (outermost) (24b)
CTTTACTTGATACTCTCCCCTTAG
>Probe|12660210|PRIMERR Reverse PCR primer (outermost) (26b)
CTTTCTTTTGATAGGTCTGAACATTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G347870 cr10000SHGC4-687
Homo sapiensradiation hybridTNG475210 cr50000SHGC4-687
Homo sapienslinkageRutgers Map4 cmD4S869
Homo sapiensradiation hybridNCBI RH41474.3 crSHGC4-687

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID40682
Probe Cross-refcontext specific help for: Probe Cross-refGDB:193473
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center