Display Settings:

Format

Send to:

Choose Destination
Pr012658600

STS probe DXS7480 for membrane bound transcription factor peptidase, site 2 (MBTPS2) and 2 more genes

Synopsis

Field NameValues
NameDXS7480
AliasesHSC06B012; WI-6294; sWXD2674
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100591951; MBTPS2; MBTPS2
UniSTS IDUniSTS:40537

Sequences

>Probe|12658600|PRIMERF Forward PCR primer (outermost) (25b)
CTTGGTTTTTAAAAAAGTGACTTGC
>Probe|12658600|PRIMERR Reverse PCR primer (outermost) (25b)
ATTTTTAGGTAGACAATCATTTGGG

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS7480
Homo sapiensphysicalWUSTL-XX6 ordinalsWXD2674

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID40537
Probe Cross-refcontext specific help for: Probe Cross-refGDB:588056
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center