Display Settings:

Format

Send to:

Choose Destination
Pr012655523

Homo sapiens STS probe D2S435

Synopsis

Field NameValues
NameD2S435
AliasesCHLC.934; CHLC.GATA5B07; CHLC.GATA5B07.934; CHLC.GATA5B07.P6987; GATA-D2S435; GATA-P6987; GATA5B07; RH30276; RH33945; RH4903; SHGC-17695; SHGC-4058
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:40260

Sequences

>Probe|12655523|PRIMERF Forward PCR primer (outermost) (24b)
CTTCTTCATAGTAAATCTCCCTCC
>Probe|12655523|PRIMERR Reverse PCR primer (outermost) (22b)
AGTGGAGAACACAAGAACACTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G323501 cr10000SHGC-17695
Homo sapienslinkageRutgers Map2 cmD2S435
Homo sapienslinkagedeCODE2107.75 cmD2S435
Homo sapiensradiation hybridNCBI RH2443.1 crSHGC-17695

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID40260
Probe Cross-refcontext specific help for: Probe Cross-refGDB:686712
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center