Display Settings:

Format

Send to:

Choose Destination
Pr012654181

STS probe REN76592 for solute carrier family 5 member 1 (SLC5A1) and 1 more gene

Synopsis

Field NameValues
NameREN76592
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSLC5A1; SLC5A1
UniSTS IDUniSTS:401392

Sequences

>Probe|12654181|PRIMERF Forward PCR primer (outermost) (23b)
CCTGGCACCTTGACTCTGGTACT
>Probe|12654181|PRIMERR Reverse PCR primer (outermost) (24b)
CAAATATTTTCACGGTCAAAGCAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmREN76592

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID401392
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center