Display Settings:

Format

Send to:

Choose Destination
Pr012654005

STS probe REN76433 for solute carrier family 5 member 1 (SLC5A1) and 2 more genes

Synopsis

Field NameValues
NameREN76433
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSLC5A1; SLC5A1; SLC5A1
UniSTS IDUniSTS:401233

Sequences

>Probe|12654005|PRIMERF Forward PCR primer (outermost) (28b)
ACCCTTATCAGATATATGACTTGCAAAA
>Probe|12654005|PRIMERR Reverse PCR primer (outermost) (28b)
TCAAAGCCCTAAATATAAGCACTAAAAC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmREN76433

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID401233
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center