Display Settings:

Format

Send to:

Choose Destination
Pr012649306

STS probe D15S1330 for arrestin domain containing 4 (ARRDC4) and 4 more genes

Synopsis

Field NameValues
NameD15S1330
AliasesRH7977; RH95317; SHGC-11768
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100427455; ARRDC4; ARRDC4; ARRDC4; ARRDC4
UniSTS IDUniSTS:39700

Sequences

>Probe|12649306|PRIMERF Forward PCR primer (outermost) (23b)
CTTACCAAAAACATAACGCTTGC
>Probe|12649306|PRIMERR Reverse PCR primer (outermost) (21b)
TTGAAAAAACAAAAACGTGGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 4 References...

3.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

4.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3153606 cr10000SHGC-11768
Homo sapiensradiation hybridGeneMap99-G3153601 cr10000SHGC-11768
Homo sapiensradiation hybridTNG1540660 cr50000SHGC-11768
Homo sapienslinkageRutgers Map15 cmD15S1330
Homo sapiensradiation hybridNCBI RH15729.2 crSHGC-11768

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID39700
Probe Cross-refcontext specific help for: Probe Cross-refGDB:737926; GDB:738799
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center