Display Settings:

Format

Send to:

Choose Destination
Pr012648749

STS probe D12S2127 for ARP6 actin related protein 6 homolog (ACTR6) and 4 more genes

Synopsis

Field NameValues
NameD12S2127
AliasesRH14229; SHGC-15767
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesACTR6; ACTR6; DEPDC4; ACTR6; ACTR6
UniSTS IDUniSTS:3965

Sequences

>Probe|12648749|PRIMERF Forward PCR primer (outermost) (25b)
AAGATCAGTCTTTCCAACTTTAGAA
>Probe|12648749|PRIMERR Reverse PCR primer (outermost) (21b)
TGAAAGCACAAATTTAACGGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3124166 cr10000SHGC-15767
Homo sapiensradiation hybridGeneMap99-G3124112 cr10000SHGC-15767
Homo sapienslinkageRutgers Map12 cmD12S2127

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID3965
Probe Cross-refcontext specific help for: Probe Cross-refGDB:740834
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center