Display Settings:

Format

Send to:

Choose Destination
Pr012648603

STS probe REN71568 for septin 8 (SEPTIN8) and 5 more genes

Synopsis

Field NameValues
NameREN71568
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSEPTIN8; LOC100072845; SEPTIN8; SEPTIN8; SEPT8; SEPTIN8
UniSTS IDUniSTS:396368

Sequences

>Probe|12648603|PRIMERF Forward PCR primer (outermost) (30b)
GGCATACTTTATACATAAGAAAGGTTTAGC
>Probe|12648603|PRIMERR Reverse PCR primer (outermost) (22b)
CTGCGTGGTCTGGTATACATGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmREN71568

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID396368
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center