Display Settings:

Format

Send to:

Choose Destination
Pr012648587

STS probe REN71553 for septin 8 (SEPTIN8) and 4 more genes

Synopsis

Field NameValues
NameREN71553
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSEPTIN8; SEPTIN8; SEPT8; CCNI2; LOC649438
UniSTS IDUniSTS:396353

Sequences

>Probe|12648587|PRIMERF Forward PCR primer (outermost) (24b)
GCTGAAGAAAATGGAGATGGAAAA
>Probe|12648587|PRIMERR Reverse PCR primer (outermost) (24b)
CAGCAGGGAGGCAAAGTAAAGTAT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmREN71553

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID396353
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center