Display Settings:

Format

Send to:

Choose Destination
Pr012647616

STS probe D7S2545 for lysine methyltransferase 2E (KMT2E) and 3 more genes

Synopsis

Field NameValues
NameD7S2545
AliasesAFMa052ya5; sWSS1763
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesKMT2E; KMT2E; KMT2E; KMT2E
UniSTS IDUniSTS:39548

Sequences

>Probe|12647616|PRIMERF Forward PCR primer (outermost) (20b)
CTGTTTAACGGTTTCTTTTC
>Probe|12647616|PRIMERR Reverse PCR primer (outermost) (20b)
ATTAAATAGGATGTGGGGAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmD7S2545

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID39548
Probe Cross-refcontext specific help for: Probe Cross-refGDB:3754329
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center