Display Settings:

Format

Send to:

Choose Destination
Pr012642554

STS probe REN66121 for MET proto-oncogene, receptor tyrosine kinase (MET) and 3 more genes

Synopsis

Field NameValues
NameREN66121
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMET; MET; MET; MET
UniSTS IDUniSTS:390921

Sequences

>Probe|12642554|PRIMERF Forward PCR primer (outermost) (22b)
GATCCTGGGGCTTAAGGAACTG
>Probe|12642554|PRIMERR Reverse PCR primer (outermost) (28b)
GAAATATTGCTCATTTATTTCCACATTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmREN66121

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID390921
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center