Display Settings:

Format

Send to:

Choose Destination
Pr012642496

STS probe L17809

Synopsis

Field NameValues
NameL17809
AliasHUMUT1397
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:39087

Sequences

>Probe|12642496|PRIMERF Forward PCR primer (outermost) (20b)
CTGGTGACAGAGTGAGACTC
>Probe|12642496|PRIMERR Reverse PCR primer (outermost) (19b)
GATTACAGGCATGAGCCAC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID39087
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is temporarily unavailable.

Support Center