Display Settings:

Format

Send to:

Choose Destination
Pr012638880

STS probe REN62812 for cystic fibrosis transmembrane conductance regulator (CFTR) and 5 more genes

Synopsis

Field NameValues
NameREN62812
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100133436; LOC100134538; CFTR; CFTR; CFTR; CFTR
UniSTS IDUniSTS:387612

Sequences

>Probe|12638880|PRIMERF Forward PCR primer (outermost) (24b)
TCTACTTCTACTGCAGTGCCTTCC
>Probe|12638880|PRIMERR Reverse PCR primer (outermost) (28b)
GCTAAGTGGAAATTAAACAAATACAAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmREN62812

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID387612
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center