Display Settings:

Format

Send to:

Choose Destination
Pr012636345

STS probe D16S407 for glutamate ionotropic receptor NMDA type subunit 2A (GRIN2A) and 2 more genes

Synopsis

Field NameValues
NameD16S407
AliasesAFM113xe3; RH241; RH97236; SHGC-27
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGRIN2A; LOC729928; LOC737097
UniSTS IDUniSTS:38533

Sequences

>Probe|12636345|PRIMERF Forward PCR primer (outermost) (21b)
CTGCTCCAATGCTTCTCCCTG
>Probe|12636345|PRIMERR Reverse PCR primer (outermost) (25b)
AGAACTTAGAAGGAAGCATGTGGGA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G316476 cr10000SHGC-27
Homo sapiensradiation hybridGeneMap99-G316436 cr10000AFM113xe3
Homo sapiensradiation hybridNCBI RH16105.8 crSHGC-27

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID38533
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center