Display Settings:

Format

Send to:

Choose Destination
Pr012628092

STS probe D4S2671 for coiled-coil serine rich protein 1 (CCSER1) and 3 more genes

Synopsis

Field NameValues
NameD4S2671
AliasesMR10872; RH38447; RH72057; SHGC-24972; WI-5639
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCCSER1; CCSER1; CCSER1; CCSER1
UniSTS IDUniSTS:37790

Sequences

>Probe|12628092|PRIMERF Forward PCR primer (outermost) (23b)
CTGAACAACTGTGGCTATCTTTG
>Probe|12628092|PRIMERR Reverse PCR primer (outermost) (23b)
CATAACAAAAGAAGTTGGGATGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G345267 cr10000SHGC-24972
Homo sapienslinkageRutgers Map4 cmD4S2671
Homo sapiensradiation hybridNCBI RH41066.5 crSHGC-24972

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID37790
Probe Cross-refcontext specific help for: Probe Cross-refGDB:458609
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center