Display Settings:

Format

Send to:

Choose Destination
Pr012627733

STS probe REN52777 for desmin (DES) and 6 more genes

Synopsis

Field NameValues
NameREN52777
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100288941; LOC100289976; LOC100291560; LOC100430577; DES; DES; DES
UniSTS IDUniSTS:377577

Sequences

>Probe|12627733|PRIMERF Forward PCR primer (outermost) (21b)
ACCTGGAGTCTGGGGAAGAAA
>Probe|12627733|PRIMERR Reverse PCR primer (outermost) (24b)
CTTAGAGGGCAGGTGGTATGAGAT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmREN52777

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID377577
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center