Display Settings:

Format

Send to:

Choose Destination
Pr012626385

STS probe G35548 for regulator of G protein signaling 6 (RGS6) and 4 more genes

Synopsis

Field NameValues
NameG35548
Aliash14a508
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesRGS6; RGS6; RGS6; RGS6; RGS6
UniSTS IDUniSTS:37636

Sequences

>Probe|12626385|PRIMERF Forward PCR primer (outermost) (21b)
CTCTTCATTGGAGTATTCAGG
>Probe|12626385|PRIMERR Reverse PCR primer (outermost) (20b)
CAATGTCCCCATCTCAGAGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmG35548

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID37636
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center