Display Settings:

Format

Send to:

Choose Destination
Pr012623563

STS probe A005Q24 for beta 3-glucosyltransferase (B3GLCT) and 3 more genes

Synopsis

Field NameValues
NameA005Q24
AliasRH66937
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesB3GLCT; B3GLCT; B3GLCT; B3GLCT
UniSTS IDUniSTS:37382

Sequences

>Probe|12623563|PRIMERF Forward PCR primer (outermost) (20b)
CTCTCAGTGGTAACAGTTAG
>Probe|12623563|PRIMERR Reverse PCR primer (outermost) (20b)
CACCTTCATGTCATCTATAA

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB41395 cr3000A005Q24
Homo sapienslinkageRutgers Map13 cmA005Q24
Homo sapiensradiation hybridNCBI RH13270.7 crA005Q24

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID37382
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center