Display Settings:

Format

Send to:

Choose Destination
Pr012620812

STS probe D20S826 for transglutaminase 6 (TGM6) and 2 more genes

Synopsis

Field NameValues
NameD20S826
AliasesRH31973; SHGC-2797
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTGM6; TGM6; TGM6
UniSTS IDUniSTS:37134

Sequences

>Probe|12620812|PRIMERF Forward PCR primer (outermost) (24b)
CTCCTCATAACCATTGAGCCATAC
>Probe|12620812|PRIMERR Reverse PCR primer (outermost) (25b)
TTAGCAACGTGCATATACAGAATCC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G320118 cr10000SHGC-2797
Homo sapienslinkageRutgers Map20 cmD20S826
Homo sapiensradiation hybridNCBI RH2020.2 crSHGC-2797

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID37134
Probe Cross-refcontext specific help for: Probe Cross-refGDB:598495
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center