Display Settings:

Format

Send to:

Choose Destination
Pr012620199

STS probe REN45989 for UDP glucuronosyltransferase family 1 member A10 (UGT1A10) and 11 more genes

Synopsis

Field NameValues
NameREN45989
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesUGT1A3; UGT1A6; UGT1A10; UGT1A8; UGT1A7; UGT1A6; UGT1A5; UGT1A9; UGT1A4; UGT1A1; UGT1A3; LOC739942
UniSTS IDUniSTS:370789

Sequences

>Probe|12620199|PRIMERF Forward PCR primer (outermost) (24b)
AGTGGGAGTTGAACAGTGAGAATG
>Probe|12620199|PRIMERR Reverse PCR primer (outermost) (25b)
CAAGAATCTCTCAAATGGCTTTATG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmREN45989

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID370789
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center