Display Settings:

Format

Send to:

Choose Destination
Pr012618213

STS probe D14S1335 for G protein-coupled receptor class C group 5 member C (GPRC5C) and 7 more genes

Synopsis

Field NameValues
NameD14S1335
AliasesRH13881; SHGC-11589
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGPRC5C; LOC100289576; LOC100292287; GPRC5C; GPRC5C; GPRC5C; GPRC5C; GPRC5C
UniSTS IDUniSTS:36900

Sequences

>Probe|12618213|PRIMERF Forward PCR primer (outermost) (20b)
CTCCAGAGAAACATAGGCGC
>Probe|12618213|PRIMERR Reverse PCR primer (outermost) (20b)
CCACCCACTCCTCAGTGTTT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3173196 cr10000SHGC-11589
Homo sapiensradiation hybridGeneMap99-G3173697 cr10000SHGC-11589
Homo sapienslinkageRutgers Map17 cmD14S1335
Homo sapiensradiation hybridNCBI RH17759.5 crSHGC-11589

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID36900
Probe Cross-refcontext specific help for: Probe Cross-refGDB:741107; GDB:741995
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center