Display Settings:

Format

Send to:

Choose Destination
Pr012614883

STS probe WI-7264

Synopsis

Field NameValues
NameWI-7264
AliasesPCDH2; UTR-03697
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:3660

Sequences

>Probe|12614883|PRIMERF Forward PCR primer (outermost) (21b)
AAGAAGAAGTCGGCAAGAAGG
>Probe|12614883|PRIMERR Reverse PCR primer (outermost) (20b)
TTGGAAGATGGAGGGTTCAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:679095
UniSTS IDcontext specific help for: UniSTS ID3660
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center