Display Settings:

Format

Send to:

Choose Destination
Pr012610740

STS probe D16S2635 for C-type lectin domain containing 19A (CLEC19A)

Synopsis

Field NameValues
NameD16S2635
AliasesMR11826; RH4122; RH54842; WI-6467
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneCLEC19A
UniSTS IDUniSTS:36227

Sequences

>Probe|12610740|PRIMERF Forward PCR primer (outermost) (20b)
CTATGGGCAGCAGCACATTT
>Probe|12610740|PRIMERR Reverse PCR primer (outermost) (22b)
CCTAGACCCTGTCTCAAACAAT

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmD16S2635
Homo sapiensradiation hybridNCBI RH16165.7 crWI-6467
Homo sapiensradiation hybridWhitehead-RH1689.7 cr3000WI-6467

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID36227
Probe Cross-refcontext specific help for: Probe Cross-refGDB:458822
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center