Display Settings:

Format

Send to:

Choose Destination
Pr012610711

STS probe REN37443 for stereocilin (STRC) and 4 more genes

Synopsis

Field NameValues
NameREN37443
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100434832; LOC100436701; STRC; STRCP1; LOC742617
UniSTS IDUniSTS:362243

Sequences

>Probe|12610711|PRIMERF Forward PCR primer (outermost) (24b)
CAGAAGCCTTACAGCTGACTGAGA
>Probe|12610711|PRIMERR Reverse PCR primer (outermost) (19b)
GGTGCTGAGTTGGGAGCAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID362243
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center