Display Settings:

Format

Send to:

Choose Destination
Pr012610576

STS probe REN37321 for stereocilin (STRC) and 5 more genes

Synopsis

Field NameValues
NameREN37321
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100436701; STRC; LOC649989; LOC713085; LOC731396; LOC749494
UniSTS IDUniSTS:362121

Sequences

>Probe|12610576|PRIMERF Forward PCR primer (outermost) (25b)
TCTCCTTCAAAGCTTCTAGGGATCT
>Probe|12610576|PRIMERR Reverse PCR primer (outermost) (24b)
GTCTGGGTTCTACATGTGCTCTTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmREN37321

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID362121
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center