Display Settings:

Format

Send to:

Choose Destination
Pr012610235

STS probe REN37015 for tumor protein p53 binding protein 1 (TP53BP1) and 4 more genes

Synopsis

Field NameValues
NameREN37015
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTP53BP1; TP53BP1; TP53BP1; TP53BP1; TP53BP1
UniSTS IDUniSTS:361815

Sequences

>Probe|12610235|PRIMERF Forward PCR primer (outermost) (24b)
GGATGAGGCAACAGGTACAGATAA
>Probe|12610235|PRIMERR Reverse PCR primer (outermost) (26b)
TGTGCTAGTGTCACTGATTAGATTGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmREN37015

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID361815
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center