Display Settings:

Format

Send to:

Choose Destination
Pr012591481

STS probe G33939 for protein phosphatase 2 regulatory subunit Bgamma (PPP2R2C) and 1 more gene

Synopsis

Field NameValues
NameG33939
AliasSHGC-50913
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPPP2R2C; PPP2R2C
UniSTS IDUniSTS:34493

Sequences

>Probe|12591481|PRIMERF Forward PCR primer (outermost) (18b)
CGATGAGTATGGGGCCTG
>Probe|12591481|PRIMERR Reverse PCR primer (outermost) (20b)
GAGAAGACTCTCGGCCAATG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmG33939

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID34493
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center