Display Settings:

Format

Send to:

Choose Destination
Pr012589669

STS probe REN18498 for coagulation factor X (F10) and 6 more genes

Synopsis

Field NameValues
NameREN18498
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100293006; KARSP2; F10; F10; F10; F10; F10
UniSTS IDUniSTS:343298

Sequences

>Probe|12589669|PRIMERF Forward PCR primer (outermost) (24b)
AAAGAGAGTGCATGGAAGAGACCT
>Probe|12589669|PRIMERR Reverse PCR primer (outermost) (19b)
GGCACTGATGTCCCTGTGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map13 cmREN18498

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID343298
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center