Display Settings:

Format

Send to:

Choose Destination
Pr012584848

STS probe REN14156 for exostosin glycosyltransferase 1 (EXT1) and 4 more genes

Synopsis

Field NameValues
NameREN14156
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesEXT1; EXT1; EXT1; EXT1; EXT1
UniSTS IDUniSTS:338956

Sequences

>Probe|12584848|PRIMERF Forward PCR primer (outermost) (24b)
GACATGATCAAAATGGTCGTGAAC
>Probe|12584848|PRIMERR Reverse PCR primer (outermost) (24b)
GCAGTTATTGCAGCATTTGTCAAC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map8 cmREN14156

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID338956
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center