Display Settings:

Format

Send to:

Choose Destination
Pr012584229

STS probe REN13599 for exostosin glycosyltransferase 1 (EXT1) and 3 more genes

Synopsis

Field NameValues
NameREN13599
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesEXT1; EXT1; EXT1; EXT1
UniSTS IDUniSTS:338399

Sequences

>Probe|12584229|PRIMERF Forward PCR primer (outermost) (25b)
GCTCCTGCAGCTTCTATTAAAACAC
>Probe|12584229|PRIMERR Reverse PCR primer (outermost) (27b)
TGACCCTAGAGTTGGAAATTTAGTAGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map8 cmREN13599

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID338399
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center