Display Settings:

Format

Send to:

Choose Destination
Pr012584087

STS probe REN13470 for exostosin glycosyltransferase 1 (EXT1) and 1 more gene

Synopsis

Field NameValues
NameREN13470
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesEXT1; EXT1
UniSTS IDUniSTS:338270

Sequences

>Probe|12584087|PRIMERF Forward PCR primer (outermost) (23b)
AGACGGGTGAGAACATTGAATTG
>Probe|12584087|PRIMERR Reverse PCR primer (outermost) (25b)
TCTCGTTTTGCATTTAACAGAGTTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map8 cmREN13470

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID338270
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center