Display Settings:

Format

Send to:

Choose Destination
Pr012580297

STS probe D12S58 for ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B)

Synopsis

Field NameValues
NameD12S58
AliasesHUMSTSAA; Mfd73A
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneANKS1B
UniSTS IDUniSTS:33486

Sequences

>Probe|12580297|PRIMERF Forward PCR primer (outermost) (19b)
CCTGGAAAAATGGCTCACC
>Probe|12580297|PRIMERR Reverse PCR primer (outermost) (20b)
GGAAAATCAGTCTCTAGTTG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmD12S58
Homo sapienslinkageMarshfield12104.65 cmMfd73A

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID33486
Probe Cross-refcontext specific help for: Probe Cross-refGDB:191698
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center