Display Settings:

Format

Send to:

Choose Destination
Pr012571012

STS probe L77264 for Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 (AMMECR1) and 1 more gene

Synopsis

Field NameValues
NameL77264
AliasesHUMSWX1198; sWXD1198
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesRTL9; AMMECR1
UniSTS IDUniSTS:32650

Sequences

>Probe|12571012|PRIMERF Forward PCR primer (outermost) (19b)
CCTAATAAACACCAGGCAC
>Probe|12571012|PRIMERR Reverse PCR primer (outermost) (26b)
GTATGATAAGCATAATACAAATGACC

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmL77264
Homo sapiensphysicalWUSTL-XX1.3 ordinalsWXD1198

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID32650
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center