Display Settings:

Format

Send to:

Choose Destination
Pr012562073

STS probe D5S1962 for WD repeat domain 41 (WDR41)

Synopsis

Field NameValues
NameD5S1962
AliasesA137ZF1; AFMA137ZF1; AFMa137zf1; HSA137ZF1; RH30916; SHGC-20279; W5495
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneWDR41
UniSTS IDUniSTS:31845

Sequences

>Probe|12562073|PRIMERF Forward PCR primer (outermost) (20b)
CCCGCCTGACGAATTTTATG
>Probe|12562073|PRIMERR Reverse PCR primer (outermost) (22b)
GATTGTAATGTGCCCCACAAAG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 6 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

5.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

6.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G352790 cr10000SHGC-20279
Homo sapiensradiation hybridGeneMap99-G352785 cr10000AFMa137zf1
Homo sapienslinkageRutgers Map5 cmD5S1962
Homo sapienslinkageMarshfield581.95 cmAFMa137zf1
Homo sapienslinkagedeCODE592.08 cmD5S1962
Homo sapienslinkageGenethon582.8 cmAFMa137zf1
Homo sapiensradiation hybridNCBI RH5363.9 crAFMa137zf1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID31845
Probe Cross-refcontext specific help for: Probe Cross-refGDB:603506
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center