Display Settings:

Format

Send to:

Choose Destination
Pr012555602

STS probe G17974 for KAT8 regulatory NSL complex subunit 1 (KANSL1) and 6 more genes

Synopsis

Field NameValues
NameG17974
AliasSHGC-3270
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100294337; KANSL1; KANSL1; KANSL1; KANSL1-AS1; LOC649063; LOC736099
UniSTS IDUniSTS:31262

Sequences

>Probe|12555602|PRIMERF Forward PCR primer (outermost) (23b)
CCCACTGAAACCTACCTTATACC
>Probe|12555602|PRIMERR Reverse PCR primer (outermost) (24b)
ATTTACTCCTTACCCCTTGCCTCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmG17974

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID31262
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center