Display Settings:

Format

Send to:

Choose Destination
Pr012555468

STS probe D22S636 for immunoglobulin lambda locus (IGL) and 3 more genes

Synopsis

Field NameValues
NameD22S636
AliasesAC22-362; PH838; RH27869; WI-362; stSG5951
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesIGL; LOC458683; PRAMENP; LOC649188
UniSTS IDUniSTS:3125

Sequences

>Probe|12555468|PRIMERF Forward PCR primer (outermost) (20b)
AACCTTCTGATGGCTCCTCT
>Probe|12555468|PRIMERR Reverse PCR primer (outermost) (20b)
CATGGAGCTGACACTGAGTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmD22S636

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID3125
Probe Cross-refcontext specific help for: Probe Cross-refGDB:336004
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center