Display Settings:

Format

Send to:

Choose Destination
Pr012549769

STS probe RH78008 for potassium channel tetramerization domain containing 7 (KCTD7)

Synopsis

Field NameValues
NameRH78008
AliasstSG40106
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneKCTD7
UniSTS IDUniSTS:30737

Sequences

>Probe|12549769|PRIMERF Forward PCR primer (outermost) (20b)
CCATCCTTCCCCACTCAGTA
>Probe|12549769|PRIMERR Reverse PCR primer (outermost) (20b)
TCTTCCGTGAAGGTGGTACC

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB47381.78 cr3000stSG40106
Homo sapienslinkageRutgers Map7 cmRH78008

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID30737
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center