Display Settings:

Format

Send to:

Choose Destination
Pr012549158

STS probe D11S4620 for teneurin transmembrane protein 4 (TENM4) and 3 more genes

Synopsis

Field NameValues
NameD11S4620
AliasesRH29329; SHGC-12273
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTENM4; TENM4; TENM4; TENM4
UniSTS IDUniSTS:30682

Sequences

>Probe|12549158|PRIMERF Forward PCR primer (outermost) (19b)
CCATCACCCAAAATAGGGG
>Probe|12549158|PRIMERR Reverse PCR primer (outermost) (20b)
GGGTCTGTGGCCAGGTAGTA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3113431 cr10000SHGC-12273
Homo sapienslinkageRutgers Map11 cmD11S4620

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID30682
Probe Cross-refcontext specific help for: Probe Cross-refGDB:740369
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center