Display Settings:

Format

Send to:

Choose Destination
Pr012546604

Homo sapiens STS probe D1S471

Synopsis

Field NameValues
NameD1S471
Aliases281YG1; AFM281yg1; HS281YG1; RH49169; stSG14147
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:30452

Sequences

>Probe|12546604|PRIMERF Forward PCR primer (outermost) (18b)
CCAGTAACACAGTGCCCA
>Probe|12546604|PRIMERR Reverse PCR primer (outermost) (25b)
CCATTAAAATTGATGATATCGATTC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmD1S471
Homo sapienslinkageMarshfield1227.81 cmAFM281yg1
Homo sapienslinkagedeCODE1212.92 cmD1S471
Homo sapienslinkageGenethon1232 cmAFM281yg1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID30452
Probe Cross-refcontext specific help for: Probe Cross-refGDB:199728
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center