Display Settings:

Format

Send to:

Choose Destination
Pr012545345

STS probe ECD22397 for interleukin 10 receptor subunit beta (IL10RB) and 2 more genes

Synopsis

Field NameValues
NameECD22397
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesIL10RB; IL10RB; IL10RB
UniSTS IDUniSTS:303385

Sequences

>Probe|12545345|PRIMERF Forward PCR primer (outermost) (22b)
GAAAATCGACCTCAACTCAAGG
>Probe|12545345|PRIMERR Reverse PCR primer (outermost) (22b)
CATCAAGATGGCAAACTAGAGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map21 cmECD22397

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID303385
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center