Display Settings:

Format

Send to:

Choose Destination
Pr012544433

STS probe ECD21568 for carnitine O-acetyltransferase (CRAT) and 2 more genes

Synopsis

Field NameValues
NameECD21568
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCRAT; CRAT; CRAT
UniSTS IDUniSTS:302563

Sequences

>Probe|12544433|PRIMERF Forward PCR primer (outermost) (20b)
GGGAGATGTGGTCCTAGCAA
>Probe|12544433|PRIMERR Reverse PCR primer (outermost) (20b)
CTACTGAGGTGGGCCAGAAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map9 cmECD21568

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID302563
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center