Display Settings:

Format

Send to:

Choose Destination
Pr012540474

STS probe SHGC-35430 for glucokinase regulator (GCKR) and 3 more genes

Synopsis

Field NameValues
NameSHGC-35430
AliasesRH37730; RH56696; RH73632; SGC35430; STS_Z48475
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGCKR; GCKR; GCKR; GCKR
UniSTS IDUniSTS:2990

Sequences

>Probe|12540474|PRIMERF Forward PCR primer (outermost) (19b)
AACCCATGTTTCTGGGTGG
>Probe|12540474|PRIMERR Reverse PCR primer (outermost) (23b)
CGGTGAGAGTAGAAACCACTAGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 5 References...

3.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

4.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

5.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G321216 cr10000SHGC-35430
Homo sapiensradiation hybridGeneMap99-G321211 cr10000SHGC-35430
Homo sapiensradiation hybridTNG219979 cr50000SHGC-35430
Homo sapiensradiation hybridGeneMap99-GB4297.79 cr3000SGC35430
Homo sapienslinkageRutgers Map2 cmSHGC-35430
Homo sapiensradiation hybridWhitehead-RH2146.6 cr3000SGC35430

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID2990
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center