Display Settings:

Format

Send to:

Choose Destination
Pr012538140

STS probe ECD15884 for FERM domain containing 5 (FRMD5) and 3 more genes

Synopsis

Field NameValues
NameECD15884
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFRMD5; FRMD5; FRMD5; FRMD5
UniSTS IDUniSTS:296899

Sequences

>Probe|12538140|PRIMERF Forward PCR primer (outermost) (20b)
CAGCAGTTCAGGGAGCAGTT
>Probe|12538140|PRIMERR Reverse PCR primer (outermost) (20b)
CAGTGTCCTTTGGTCCCTTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmECD15884

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID296899
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center