Display Settings:

Format

Send to:

Choose Destination
Pr012528937

STS probe ECD07562 for interleukin 1 receptor associated kinase 1 (IRAK1) and 3 more genes

Synopsis

Field NameValues
NameECD07562
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesIRAK1; IRAK1; IRAK1; MECP2
UniSTS IDUniSTS:288613

Sequences

>Probe|12528937|PRIMERF Forward PCR primer (outermost) (20b)
GGGTTCCTAAGCAGTGGTTC
>Probe|12528937|PRIMERR Reverse PCR primer (outermost) (19b)
ACATCCTTCCCAGGTGGAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmECD07562

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID288613
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center